Getting started

Installation

CRISPRzip is available on PyPi and can be installed with pip.

User installation

Although CRISPRzip can be directly installed from pip, creating a virtual environment makes it easier to manage dependencies. Below you can see some intructions on how to generate a virtual environment with venv assuming you already have python installed in a bash-like terminal.

python -m venv crisprzip-venv
source crisprzip-venv/bin/activate
pip install crisprzip

Developer installation

To be able to make changes and contributions to CRISPRzip, you will need to get your own copy of the source code and install software dependencies on your own. Assuming you have a python and git installed in a bash-like terminal, the installation process can be done with the following instructions.

git clone https://github.com/hiddeoff/crisprzip.git
cd crisprzip
python -m venv crisprzip-venv
source crisprzip-venv/bin/activate
pip install -e .

Please use our contributing guidelines if you would like us to consider your developments in a future CRISPRzip release

Verifying installation

CRISPRzip development includes a cross-platform compatibility and test workflow. If you would like to verify your local installation, please follow the Developer Installation instructions, then run the following test.

source crisprzip-venv/bin/activate
pip install -e '.[tests]'  # installs pytest and pandas
pytest tests/cleavage_binding_prediction/test_cleavage_binding_prediction.py -v

You can also follow the user installation and execute the code in the Usage section below.

Usage

CRISPRzip makes predictions about cleavage and binding activity on on- and off-targets. First, you define the protospacer and target sequence, and then, you can predict the fraction cleaved or bound.

# 1. load parameter set
from crisprzip.kinetics import load_landscape
searcher = load_landscape("sequence_params")

# 2. define Cas9, gRNA and DNA target
searchertargetcomplex = searcher.probe_sequence(
    protospacer = "AGACGCATAAAGATGAGACGCTGG",
    target_seq  = "AGACCCATTAAGATGAGACGCGGG",  # A13T G17C
)

# 3. predict activity
f_clv = searchertargetcomplex.get_cleaved_fraction(
    time=600,  # 10 minutes
    on_rate=1E-1
)
f_bnd = searchertargetcomplex.get_bound_fraction(
    time=600,  # 10 minutes
    on_rate=1E-1
)

# 4. format output
print(f"After 10 minutes, the target (A13T G17C) is ...")
print(f"- cleaved for {100 * f_clv:.1f}% by Cas9")
print(f"    or  ")
print(f"- bound for {100 * f_bnd:.1f}% by dCas9")

Output:

After 10 minutes, the target (A13T G17C) is ...
- cleaved for 10.5% by Cas9
    or  
- bound for 94.2% by dCas9

See the tutorial for more examples how to explore sequence, time and concentration dependency.