# Getting started ## Installation CRISPRzip is available on [PyPi](https://pypi.org/) and can be installed with [pip](https://pip.pypa.io/en/stable/). ### User installation Although CRISPRzip can be directly installed from pip, creating a virtual environment makes it easier to manage dependencies. Below you can see some intructions on how to generate a virtual environment with [venv](https://docs.python.org/3/library/venv.html) assuming you already have python installed in a bash-like terminal. ```shell python -m venv crisprzip-venv source crisprzip-venv/bin/activate pip install crisprzip ``` ### Developer installation To be able to make changes and contributions to CRISPRzip, you will need to get your own copy of the source code and install software dependencies on your own. Assuming you have a python and git installed in a bash-like terminal, the installation process can be done with the following instructions. ```shell git clone https://github.com/hiddeoff/crisprzip.git cd crisprzip python -m venv crisprzip-venv source crisprzip-venv/bin/activate pip install -e . ``` Please use our [contributing guidelines](https://github.com/hiddeoff/crisprzip/blob/main/CONTRIBUTING.md) if you would like us to consider your developments in a future CRISPRzip release ### Verifying installation CRISPRzip development includes a cross-platform compatibility and test [workflow](.github/workflows/compatibility-test.yml). If you would like to verify your local installation, please follow the Developer Installation instructions, then run the following test. ```shell source crisprzip-venv/bin/activate pip install -e '.[tests]' # installs pytest and pandas pytest tests/cleavage_binding_prediction/test_cleavage_binding_prediction.py -v ``` You can also follow the user installation and execute the code in the Usage section below. ## Usage CRISPRzip makes predictions about cleavage and binding activity on on- and off-targets. First, you define the protospacer and target sequence, and then, you can predict the fraction cleaved or bound. ```python # 1. load parameter set from crisprzip.kinetics import load_landscape searcher = load_landscape("sequence_params") # 2. define Cas9, gRNA and DNA target searchertargetcomplex = searcher.probe_sequence( protospacer = "AGACGCATAAAGATGAGACGCTGG", target_seq = "AGACCCATTAAGATGAGACGCGGG", # A13T G17C ) # 3. predict activity f_clv = searchertargetcomplex.get_cleaved_fraction( time=600, # 10 minutes on_rate=1E-1 ) f_bnd = searchertargetcomplex.get_bound_fraction( time=600, # 10 minutes on_rate=1E-1 ) # 4. format output print(f"After 10 minutes, the target (A13T G17C) is ...") print(f"- cleaved for {100 * f_clv:.1f}% by Cas9") print(f" or ") print(f"- bound for {100 * f_bnd:.1f}% by dCas9") ``` Output: ``` After 10 minutes, the target (A13T G17C) is ... - cleaved for 10.5% by Cas9 or - bound for 94.2% by dCas9 ``` See the [tutorial](./tutorial.ipynb) for more examples how to explore sequence, time and concentration dependency.